TABLE 2.

Oligonucleotides used in this study

Name5′-to-3′ sequence
5′ JAF11GCGCATATGCCATTGAGTGTTGGACAGGG
3′ JAF12GCGGGATCCCATCATATTTTCATGCCACCGG
5′ KF43GGTATTTTTTGGCGACGCGTTGTCTGACTCCTTAGG
3′ KF44CCTAAGGAGTCAGACAACGCGTCGCCAAAAAATACC
5′ KF47GGCGACAGCTTGGCTGACTCCTTAGGGC
3′ KF48GCCCTAAGGAGTCAGCCAAGCTGTCGCC
5′ KF49GGGGGCTAATAACTATATGACACTACAC
3′ KF50GTGTAGTGTCATATAGTTATTAGCCCCC
5′ KF51GACCTTGTCAACCCAACCCAGGAAGTCC
3′ KF52GGACTTCCTGGGTTGGGTTGACAAGGTC
5′ MBO71TTGCTCAAGGCGTACCGCAGCCGATGGAACTTTATTCAGTCATATGAATATCCTCCTTAG
3′ MBO72GCTAAAGCGTGTTTAATAAAGTAAGGAGGACACTATGCCAGTGTAGGCTGGAGCTGCTT