TABLE 2.

PCR primers employed in this study

PrimerSequencea
ospC 20(+) LIC GACGACGACAAGATTAATAATTCAGGGAAAGATGGG
ospC 40(+) LIC GACGACGACAAGATTCCTAATCTTACAGAAATAAGTAAAAAAAT
ospC 60(+) LIC GACGACGACAAGATTAAAGAGGTTGAAGCGTTGCT
ospC 80(+) LIC GACGACGACAAGATTAAAATACACCAAAATAATGGTTTG
ospC 100(+) LIC GACGACGACAAGATTGGAGCTTATGCAATATCAACCC
ospC 130(+) LIC GACGACGACAAGATTTGTTCTGAAACATTTACTAATAAATTAAAAG
ospC 136(+) LIC GACGACGACAAGATTAATAAATTAAAAGAAAAACACACAGATCTTG
ospC 142(+) LIC GACGACGACAAGATTCACACAGATCTTGGTAAAGAAGG
ospC 151(+) LIC GACGACGACAAGATTACTGATGCTGATGCAAAAGAAG
ospC 171(+) LIC GACGACGACAAGATTGAAGAACTTGGAAAATTATTTGAATC
ospC 191(+) LIC GACGACGACAAGATTCTTGCTAATTCAGTTAAAGAGCTTAC
ospC 130(−) LIC GACGACAAGCCCGGTTTAACATTTCTTAGCCGCATCAATTTTTTC
ospC 150(−) LIC GACGACAAGCCCGGTTTAAACACCTTCTTTACCAAGATCTGT
ospC 170(−) LIC GACGACAAGCCCGGTTTAAGCACCTTTAGTTTTAGTACCATT
ospC 190(−) LIC GACGACAAGCCCGGTTTACATCTCTTTAGCTGCTTTTGACA
ospC 200(−) LIC GACGACAAGCCCGGTTTAGCTTGTAAGCTCTTTAACTGAATTAGC
ospC 210(−) LIC GACGACAAGCCCGGTTTAAGGTTTTTTTGGACTTTCTGC
  • a LIC tail sequences are underlined.