TABLE 2.

PCR primers employed in this study

PrimerSequencea
ospC 20(+) LICGACGACGACAAGATTAATAATTCAGGGAAAGATGGG
ospC 40(+) LICGACGACGACAAGATTCCTAATCTTACAGAAATAAGTAAAAAAAT
ospC 60(+) LICGACGACGACAAGATTAAAGAGGTTGAAGCGTTGCT
ospC 80(+) LICGACGACGACAAGATTAAAATACACCAAAATAATGGTTTG
ospC 100(+) LICGACGACGACAAGATTGGAGCTTATGCAATATCAACCC
ospC 130(+) LICGACGACGACAAGATTTGTTCTGAAACATTTACTAATAAATTAAAAG
ospC 136(+) LICGACGACGACAAGATTAATAAATTAAAAGAAAAACACACAGATCTTG
ospC 142(+) LICGACGACGACAAGATTCACACAGATCTTGGTAAAGAAGG
ospC 151(+) LICGACGACGACAAGATTACTGATGCTGATGCAAAAGAAG
ospC 171(+) LICGACGACGACAAGATTGAAGAACTTGGAAAATTATTTGAATC
ospC 191(+) LICGACGACGACAAGATTCTTGCTAATTCAGTTAAAGAGCTTAC
ospC 130(−) LICGACGACAAGCCCGGTTTAACATTTCTTAGCCGCATCAATTTTTTC
ospC 150(−) LICGACGACAAGCCCGGTTTAAACACCTTCTTTACCAAGATCTGT
ospC 170(−) LICGACGACAAGCCCGGTTTAAGCACCTTTAGTTTTAGTACCATT
ospC 190(−) LICGACGACAAGCCCGGTTTACATCTCTTTAGCTGCTTTTGACA
ospC 200(−) LICGACGACAAGCCCGGTTTAGCTTGTAAGCTCTTTAACTGAATTAGC
ospC 210(−) LICGACGACAAGCCCGGTTTAAGGTTTTTTTGGACTTTCTGC
  • a LIC tail sequences are underlined.