Table 2.

Synthetic oligonucleotide primers

PrimerSequence (5′→3′)aPositionPurpose
PE1GCTGGTCCTCAATACCACGCTGATGGTGGC+30 to +60Primer extension
PE3AGCATTATCTAGAACCTCCTTAGGATCCCG lacZgenePrimer extension
FS1ATTGTGTTGTGCTCCGGGCTGGCCTTGCTG−163 to −193DNA sequencing
FS2GATAGCTCTTGCGCTACGGGCTAAA−422 to −446DNA sequencing
FP1 GGAATTCCGAGCTATCGATGGCGGGTCTCT−605 to −628Used with FP3 in PCR to obtain UPF fragment
 EcoRI
FP3 CGGGATCCCGCCAACTCCAAAAGCACGATTCGA+87 to +61Used with FP1 in PCR to obtain UPF fragment
 BamHI
MPF10CTTGCTGCTCTTGCCCGGACAGCTTGTAAC−36 to −6Unique-site elimination mutagenesis
MPS10GCTATGACAGCTTGGCCCAAAGACGGCGAGGC−24 to +8Same as above
MPF35CAAAGTTTTTCCCATTGGGACTTGCTGCTC−55 to −25Same as above
MPS35CAAAGTTTTTCTTGCACGGACTTGCTGCTC−55 to −25
MP58GTTTTTCTTGTTGGGACTTGCTGCTCTTGCAAAGA−51 to +20Deletion from −22 to −7
CAACGAGGCAGAACCCGTTACAG
MP59GTTGTTGGGCTTGCATAATTCACCGAGATGCTTG−69 to −16Deletion from −63 to −45
TTGGGACTTGCTGCTCTTGCTATGA
MP60GGATGTTGTTGGGCTTGCATAATTCACCGAGATC−89 to −69Deletion from −84 to −69
AAAAAAACAAAGTTTTTCTTGTTGGG
lacZ2GAAAGGGGGATGTGCTGCAAGGCGATTAAGCorresponding tolacZ Testing primer
MPF3TGTTGGGACTTGCTGCTCTTGCCCGTesting primer for MPF10
MPS3ACTTGCTGCTCTTGCTATGACAGCTTGGCCTesting primer for MPS10
TMPF35CAAAGTTTTTCCCATTesting primer for MPF35
TMPS35AGTTTTTCTTGCACGTesting primer for MPS35
MP16CTTGCTGCTCTTGCAATesting primer for MP58
MP15ATTCACCGAGATGCTTesting primer for MP59
MP150GCTTATGGATGTTGTTGGGCTTGCATATTCATesting primer for MP150
MP14TGGGCTTGCATAATTCACCGTesting primer for MP60
  • a Restriction sites are underlined; substituted nucleotides are italicized.