Table 1.

Primers used in this work

Primer no.Sequence
1 GCGCGCAGATCTAGCTAGCTTTCCCCATGTAACCAATCTATC
2 GCGCGCTAGCTTATCAGCTTTTGATTTCAAAAAATAGCGATAGC
3 GAGATCTTAATCATCCTAAGGAGGTATTCTGATGAGCAGAAAACTGTTTGCGTCAATC
4 AGATCTTAATCATCCTAAGGAGGTATTCTGATGGGCGCTGATGATGTTGTTGATTCTTCT
5 GCGCGGATCCTTATTATGATCGCCTGACACGATTTCCTGCACAGGCT
6 AAGCTTGGCGCTGATGATGTTGTTGATTCTTCTA
7 GCGCAGATCTTAATCATCCTAAGGAGGTATTCTGATGTATAGTACCGACAATAAATACGACGCTGCG
8 GCTAGCGGATCCTTATTAGCTCGAGCATGACAATGAGCTACCTACTGATCGC
9 CTCGAGCGCGTATTCTCCGGGGCATAAAACG
10 CGCATGCATGGGCCGGGGCCCATGAAAAACCTTGATTGTTGGGTC
11 GGATCCTCATTAGCTCGAGGGTACCCGCGGATCATGGTCGTTGGTCCAACCTTCATCGGTCGG
12 GCGTCGACTGGCGCTGATGATGTTGTTGATTCTTCTA
13 AGATCTTAATCATCCACAGGAGGATTTCTGATGTCGACTTGTGCAGGAAATCGTGTCAGGC
14 CTGCAGCTGGCGCTGATGATGTTGTTGATTC
15 ATGCATCGCTTTTTGATTTCAAAAAATAGCGATAGC