Table 2.

Oligonucleotides used for PCR and sequencing

OligonucleotideSequence (5′→3′)Positionsa
ANKA288CACGTTCTGATGTGCAATCTC3258–3278
ANKA289CAACCCGGGCTAAGGACATCCTCAGCAGC3549–3530
ANKA290GTCCTTAGCCCGGGTTGGATGTCCGATTCAGCACGGG4405–4424
ANK7191GCTTTATTCTGGCTCTCAAAAACG4739–4716
ANK14CCAGGATCCATGGATACATCAAATGCAAC2741–2760
ANK16CTTTATTTGCAACCTCAGAAGCC4924–4902
AE19bCAGGTCGTCGTGTCTGCTAAA
  • a Positions of the oligonucleotide with respect to the published sequence (EMBL accession no. Y13068 ).

  • b This oligonucleotide has been described elsewhere (13).