Table 2.

Oligonucleotides used for PCR and sequencing

OligonucleotideSequence (5′→3′)Positionsa
ANKA288 CACGTTCTGATGTGCAATCTC 3258–3278
ANKA289 CAACCCGGGCTAAGGACATCCTCAGCAGC 3549–3530
ANKA290 GTCCTTAGCCCGGGTTGGATGTCCGATTCAGCACGGG 4405–4424
ANK7191 GCTTTATTCTGGCTCTCAAAAACG 4739–4716
ANK14 CCAGGATCCATGGATACATCAAATGCAAC 2741–2760
ANK16 CTTTATTTGCAACCTCAGAAGCC 4924–4902
AE19b CAGGTCGTCGTGTCTGCTAAA
  • a Positions of the oligonucleotide with respect to the published sequence (EMBL accession no. Y13068).

  • b This oligonucleotide has been described elsewhere (13).