Table 1.

Oligonucleotides used to generate PCR probes used in this study

Target geneName of the primerSequence of the primerSource or reference
recArecAFGCGTTCAGGAAGTCTAGCTC15
recARCTGATGCTACTGCCATAGCAG15
emm1M1GAATCCACTATTCGCTTAGA4
M2GAATTCAGTTCTTCAGCTTGT4
scpAscp1GGCGAGTGGGTCAATGATAAThis study
scp2ACCGTCTTTTCGACTGATAAAG15
hasAhas1GAAAACGCCATGCTCAAGCGThis study
has2GATTGGTAGACAGTGCGTCCThis study
speAspea1GGCGGATCCGCCAACAAGACCCCGTAThis lab (22)
spea2GCGGATCCGCAGTAGGTAAGGTTGCAThis lab (22)
speBspeb1GATAACCATACGATTCAGCT15
speb2TCTGTGTCTGATGGATAGC15
mfmf1GCGAATTCGGTATAGCGCATGCCThis study
mf2CCGAATTCCAAACACAGGTCTCAThis study
16S rRNArRNA1CGGTAACTAACCAGAAAGGGThis study
rRNA2CGTTGTACCAACCATTGTAGCThis study