Table 2.

Primers used in this study

PrimerPrimer sequence (5′ to 3′)Orientation
Integrase gene
 int520 ACATCCTTGCGAATCCTTATC Forward
 c15-205 TACAGGCAGGTTCCCGATGAC Reverse
 int1597 CCTGTGGAGGTGGTGGTAAT Reverse
ybtA promoter
 ybt7524 AAACAGGGTCGGGAGAGGATT Forward
 D7 GGACATCGATTCAGTATTGGA Forward
 ybt1012 GCCATAGACGCTGTTGTTGAA Reverse
 D340 GGATTGCGTTTGCGGTGACTC Reverse
3′ end of Yen HPI
 HPI878 GGGGGCAAGAAAAACTAACC Forward
 HPI387 TCATTAAATAGTCACCCCATAG Forward
 Ye9765 CAAGTGTCACCAGCGTAGGGATTTC Forward
 HPI1220 TTTGTTTTATGGCTTTGGTAG Reverse
 HPI283 TTTCAGTGTTTCAGCGTCCAG Reverse
 3P6057 CAACTTGAGCGTGATAAACA Reverse
Left junction of Yen HPI
 W250 TCGGCTCGACGCTTTAGGTAG Forward
 W598 CCAATTTTTCCCGATGCGTAG Reverse
Right junction of HPI
 3P345 GAGGCGATCCCAGTCAGAG Forward
 Ye262 TTTTCCCCCGAGAGGCTGAGTAACC Reverse for Yen HPI
 W36878 TGGCTTCCCCGCTTTTTATCGTAT Reverse for Yps HPI
asn tRNA gene
 asn468 CCGTATGTCACTGGTTCG Forward