Table 1.

Primers used in RT-PCR

MoleculeOligonucleotideTemp (°C)Maximal no. of cyclesPCR product size (bp)Reference
IL-1αSense: CCACTACAAAATCTGGGCGATGCA663321321
Antisense: CAGAAGAAGAGGATGTCACTCCTCG
Probe: TATACTTCCTGTAACTTTAAGAATCTC
IL-1βSense: AAAGCAGTTCCCTGCCCACAGGCC663038810
Antisense: TGGGTAACGGTTGGGGTCTACACT
Probe: TGCAACACCTGGGATGACTACAGTCTTGAG
icIL-1raSense: GGACTCCACACAACCCACAAGACC643551140
Antisense: CTACTGGTCCTCCTGGAAGTAGAA
Probe: GACCCTCCCTATGGCTTCAGA
sIL-1raSense: GAAGGTCTTCTGGTTAACATCCCA643515040
Antisense: ATGAGACCCTCCAGGAGCACCCGC
Probe: AGGCACCTAATCTCCCTCCTCCTC
γ-ActinSense: CCATCGTGGGGCGTCCGCGGCA622626828
Antisense: ATCTGGGTCATCTTCTCGCGGT
Probe: GCGACGAGGCCCAGAGCAAGCGTG