Table 1.

Primers used in this study

PrimerDescriptionSequenceExpected product size (bp)
Y346.D1Flanks IS6110 insertion in M. tuberculosisH37Ra CGAATGACCACGTTTGATCACAATCGC 5,673 (H37Rv), 7,030 (H37Ra)
Y346.D2Flanks IS6110 insertion in M. tuberculosis H37Ra CGATCCGATGTCTATTCCTTGGGCTG
RvD2-17FRvD2 internal primer ACGGCAACGACAATCGTGGT 1,327 (H37Ra)
RvD2-22RRvD2 internal primer AACTCTTGAACGCCTGCG