Table 1.

Primers used in construction of the plasmid cassettes

Primer no.SequenceaCassette createdGenBank accession no.TemplateSource or reference
1 5′-GCAGGAAAGAACATGTGAG CCTAGG GCCAGCAAAAGGCCAGGAAC-3′ oriE1 J01749 pCVD315 17
2 5′-CATGACCAAAATCCCTTA ACTAGT GTTTT AGATCT ACTGAGCGTCAGACCCCG-3′ oriE1 J01749 pCVD315
3 5′-CGGGGTCTGACGCTCAGT AGATCT AAAAC ACTAGT TAAGGGATTTTGGTCATG-3′ bla J01749 pCVD315
4 5′-GCTGTCAAACATGA GAATTCTAGA AGACGAAAGGGCCTCGTGATACGCC-3′ bla J01749 pCVD315
5 5′-ACAGCCTGCAGACAGATCTTGACAGCTGGATCGCACTCTGGTATAATTGGGAAGCCCTGCAAAG-3′ aphA-2 V00618 pIB279 5
6 5′-CGAAGCCCAACCTTTCATAGAA GCTAGC GGT GGATCC GAAATCTCGTGATGGCAGGTTG-3′ aphA-2 V00618 pIB279
7 5′-AACAAGCGTTATAG GAATTC TGTGGTAGCA-3′ PompC K00541 E. coli DH5αGibco BRL
8 5′-ACTTTCATGTTATTAA AGATCT GTTATATG-3′ PompC K00541 E. coli DH5α
9 5′- AGATCT TAATCATCCACAGGAGGCTTTCTGATGAGTAAAGGAGAAGAACTTTTCACTGG-3′ gfpuv U62636 pGFPuv 13
10 5′- GCTAGC TCATTATTTGTAGAGCTCATCCATGC-3′ gfpuv U62636 pGFPuv
11 5′- AGATCTGAATTCTAGA TCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCG-3′ tetA J01749 pBR322 2
12 5′- AGATCT TATCAGGTCGAGGTGGCCCGGCTCCATGCACCGCGACGCAACGCG-3′ tetA J01749 pBR322
13 5′-CGC GAATTCTCGAG ACAAACTCCGGGAGGCAGCGTGATGCGGCAACAATCACACGGATTTC-3′ hok-sok-tetA X05813 pR1 19,24
14 5′-ATGAGCGCATTGTTAGATTTCATTTTTTTTTCCTCCTTATTT TCTAGA CAACATCAGCAAGGAGAAAGG-3′ hok-sok-tetA J01749,X05813 pR1
15 5′-CCTTTCTCCTTGCTGATGTTG TCTAGA AAATAAGGAGGAAAAAAAAATGAAATCTAACAATGCGCTCAT-3′ hok-sok-tetA X05813,J01749 pBR322 2
16 5′-GCTACATTTGAAGAGATAAATTGCACT GGATCC TAGAAATATTTTATCTGATTAATAAGATGATC-3′ ori15A X06403 pACYC184 43
17 5′-CGGAGATTTCCTGGAAGATG CCTAGG AGATACTTAACAGGGAAGTGAGAG-3′ ori15A X06403 pACYC184
18 5′-GTCTGCCGGATTGCTTATCCTGGC GGATCC GGTTGACAGTAAGACGGGTAAGCCTGTTGAT-3′ par X01654 pSC101 33
19 5′-AGGCTTAAGTAGCACCCTCGCA AGATCT GGCAAATCGCTGAATATTCCTTTTGTCTCCGAC-3′ par X01654 pSC101
20 5′-GAGGGCGCCCCAGCTGGCAAT TCTAGACTCGAG CACTTTTGTTACCCGCCAAACAAAACCCAAAAACAAC-3′ aphA-2–parA V00618,X04268 pR1 19, 24
21 5′-AGAAGAAAAATC GAATTC CAGCATGAAGAGTTTCAGAAAATGACAGAGCGTGAGCAAGTGC-3′ aphA-2–parA X04268 pR1
22 5′-GTTGTTTTTGGGTTTTGTTTGGCGGGTAACAAAAGTG CTCGAGTCTAGA ATTGCCAGCTGGGGCGCCCTC-3′ aphA-2–parA X04268,V00618 pIB279 5
23 5′-CGAAGCCCAACCTTTCATAGAA ACTAGT GGTGGAATCGAAATCTCGTGATGGCAGGTTG-3′ aphA-2–parA V00618 pIB279
  • a Relevant restriction sites are designated in boldface, underlined, and referred to in the text; ribosome binding sites and start codons are designated in italics.