Table 2.

Oligonucleotides used for constructing DNA probes

Probe Primer Sequence (5′ to 3′)Strand Site S′ enda
AK1108 TCGCCGCCTCTGGCATGGAA + ygaF
K1077 CGGCAGCCTGAAGGCGCAGT ygaF
B K929 ATGAGGTTTCCATATTTCCT + orf3 3920
K912 TAGAGACCAAGATAACAGC orf3 4333
CK948 CGTTGGCCGTAATGCTA + espC 7229
K947 GGTCTGATACCCTGTCA espC 8315
D K994 CATGAGCTGGACGGTGTGGA + espC 8535
K1315Bb CTACGAAGCTTGCGATCTTCTTGTGAGAAAGA espC 9299
E K1396 GGAAATTCAGCAGCGGCTA + orf6.1 11021
K1395 GGCAAAGGACTTTGTGGATT orf6.1 11243
F K1032 GCCGTTCGGTTCGAAACTG + orf7 13543
K1154 TTTTCACCGCCGGGAAGGC orf7 14428
G K2119 TGGATTCGACGGGATTTGCGA + ssrA
K2118 GTGCGGCTCTTAGGACTTCA ssrA
  • a 5′ position in the espCpathogenicity island.

  • b HindIII site used for cloning is underlined.