Table 2.

Oligonucleotides used in this study

PlasmidGenome designationSequence (5′ to 3′)Predicted fragment size (bp)
cp9BBC10FGAACTATTTATAATAAAAAGGAGAGC459
BBC10RATCTTCTTCAAGATATTTTATTATAC
BBC07FGATGAAAATCTTTCACAAAAG291
BBC07RAACAATAATAGAGATAAAGGG
cp26BBB19FAATAATTCAGGGAAAGATGGG573
BBB19RAGGTTTTTTTGGACTTTCTGCC
lp5BBTFCTTGCTTTAAGCCCTATTTCAC645
BBTRGCACACTACCCATTTTTGAATC
lp17BBD10FCAAACTTATCAAATAGCTTATC519
BBD10RACTGCCACCAAGTAATTTAAC
lp25BBE16FATGGGTAAAATATTATTTTTTGGG618
BBE16RAAGATTGTATTTTGGCAAAAAATTTTC
lp28-1BBF20FATGAACAAAAAATTTTCTATTTC291
BBF20RGTTGCTTTTGCAATATGAATAGG
BBFFCGCTGGACAGTTTATATTGGGG1,723
BBFRGTTGATAATGCTAATGCTGGGGAC
lp28-2BBG02FTCCCTAGTTCTAGTATCTACTAGACCG810
BBG02RTTTTTTTTGTATGCCAATTGTATAATG
lp28-3BBH06FGATGTTAGTAGATTAAATCAG651
BBH06RTAATAAAGTTTGCTTAATAGC
lp28-4BBI16FCAGGCCGGATTTTAATATCGA1,300
BBI16RGTTTATATTTTGACACTATAAG
BBI16(II)FGCAGGCCGGATTTTAATATCGATC732
BBI16(II)RGCTCATTAGATAGCGTATTTTTTAG
lp36BBK19FAAGTTTATGTTTATTATTGC316 (610)a
BBK19RATTGTTAGGTTTTTCTTTTCC
lp38BBJ34FAAATTCTATGGAAGTGATG1,010
BBJ34RTTTCTATTTATTTTTAGGC
lp54BBA16FGCACAAAAAGGTGCTGAG840
BBA16RTTTTAAAGCGTTTTTAAGC
lp56BBQ56FAAGATTGATGCAACTGGTAAAG975
BBQ56RCTGACTGTAACTGATGTATCC
  • a BBK19F anneals to both strands, yielding a 316-bp amplimer; see text for details.