Table 2.

Oligonucleotides used in this study

Primer Sequence (5′-3′)a
cm1GCAAGTCGACGGGCCCGCACCTCAAAAACACCATCATACA
cm2AGTCGTCGACAGGCGTTTAAGGGCACCAATAACTG
galEPstIAAAACTGCAGAAAAGCCGTTACAATCGCCG
galEFspIGAAAATGCGCAGGGCGTTTGTATAGCAACAG
5′galESmaITCCCCCGGGCTATCGTACGGCTCATAACA
5′galESalITACGCGTCGACATACCCGCTTGGATCATCTG
3′galESalITACGCGTCGACCGTAATCTACACACAATGGC
3′galEApaIGTAAGGGCCCAATCGGCCACGGTGGAAATT
galUPstIAACTGCAGCTAGCACACCATAGAGCAA
galUFspICCCTGCGCATGCATTGTTTAGATAGCGAAT
galU1AAGAGCTCAGCTATTGGGTGATATCCGTA
galU2GATCTAGACTTCGATATAGCCTTCAACGC
5′wbeWSmaITCCCCCGGGAATTCCCTTACCTCTTGGTGC
5′wbeWSalIACGGCTCGACCAGAAAATAGGGGAGCCAGT
3′wbeWSalIACGCGTCGACGACACCAGTAAAGCTTGCAG
3′wbeWApaIGAGGGCCCCGATGTGCGCATGAGTTAAG
  • a Underlined nucleotides are not exact matches to the sequence and were introduced to add restriction enzyme sites. Nucleotide sequences were derived from the publicly available sequences from the V. cholerae genome project (http://www.tigr.org ) (22) and accession no. X59954 andY07788 .