Table 1.

Primers and primer combinations used to identify serotype- and/or mating-type specific genes in serotype AD strains of C. neoformans

Primer Primer sequenceGene or allele
JOHE1909CTCGAGGCTTTCCCCCTTTTT MFα2serotype D
JOHE1910ATTTGAAAAAGAGATCACAGC
JOHE3067GATCTGTCTCAGCAGCCAC STE20a serotype D
JOHE3068AATATCAGCTGCGCAGGTGA
JOHE3069GATTTATCTCAGCAGCCACG STE20α serotype D
JOHE3070AAATCGGCTACGGCACGTC
JOHE5169TCCACTGGCAACCCTGCGAG STE20a serotype A
JOHE5170ATCAGAGACAGAGGAGCAAGAC
JOHE2472CCAAAAGCTGATGCTGTGGA STE20α serotype A
JOHE2578AGGACATCTATAGCAGAT STE20α serotype A
JOHE1895GGGCATATGAGCAGCTTTACACCAGCC STE11α serotype D
JOHE1896GGTACCTTAGTTCAGCTTTGTGATTGC
JOHE1671CTGAGGAATCTCAAACCAGGGA STE12α serotype A+D
JOHE1672CCAGGGCATCTAGAAACAATCG
JOHE1671As above STE12α serotype A
JOHE2189GCTTCGGATCATACCTAAAA
JOHE3065AGTCGGCTATTTCTTATCGTC CLA4 serotype D
JOHE3066AATCTGCCCATCCAAACATTG
JOHE3066As above CLA4 serotype A
JOHE3236GGCTATTTATCAATGGTTAGCGG
JOHE2926AAAAAGTTTTCGTTGGTCTTTT CNA1 serotype D
JOHE3238CCTCCATCTCGACCTGCCT
JOHE2926As above CNA1 serotype A
JOHE3239ACTATTATCCTCCATCAACCTTC
JOHE2596GCCAGAGAGATTCGATGTTG GPA1 serotype D
JOHE3240TCCACCCCATTCATACCCG
JOHE2596As above GPA1 serotype A
JOHE3241CATCGCTCCACATCTTCGTT