Table 1.

Primers used to study the cag PAI structure

Amplified area (reference)Primer namesSequence (5′→3′)
cagA(27)F1 GATAACAGCCAAGCTTTTGAGG
B1 CTGCAAAAGATTGTTTGGCAGA
picB picB/AF GGCTTTATCAAAGAATGGAGCGAGCG
picB/AR TACTCAATAGCTCTTCTATGAGC
picB/BF GTGGAGGCTCTAAAGAGCAGGGC
picB/BR TGACATACTCCCCACCCATTGCG
cag13-cag14 cag13F CAATAGTGGGAGCTTAGTGCC
cag14R GCGATTGGTGGCTACTTATCGC
virD4 virD4AF TTTATGATGATAATCGATCGCC
virD4AR GAACGCCTGCCCTGCGTAAGCG
virD4BF TTTCATAGGTTCTATGGCAAGCGGG
virD4BR TTAGCGCCATTCCTACCATAACC
cag empty site (19)Luni1 ACATTTTGGCTAAATAAACGCTG
5280 GGTTGCACGCATTTTCCCTTAATC
IS605TnpA605AF CGCCTTGATCGTTTCAGGATTAGC
605AR CAACCAACCGAAGCAAGCATAATC
IS605TnpB605BF GGCTGTTCTAGGGTCGTGTATAAC
605BR CAAGCTAGATGATGCAATCTAGCTACC
Full IS605(18)ORF18F CGCCTTGATCGTTTCAGGATTAGC
ORF19R CAAGCTAGATGCAATCTAGCTACC
cagIIcag1F TGTTGTGTCTTGAGCGGTGC
cag9R GGCGATGGTCTCTTTTATCGCC
Middle zonecag9F GGCGATAAAAGAGACCATCGCC
cag18R2 GCTGAGCAATGCGGAATAT
cagIcag18F2 ATATTCCGCATTGTTGCTCAGC
cag26R GCTTGCCTGTTATCCCTATCG