Table 1.

Primers

PrimerGeneSequence (5′ to 3′)Amplicon size (bp)Limit of detection (CFU)a
18set5′ pal TTGAGAATTCAGTAGTTCATCAGGTAAAACAGATG 400101
18set3′ TAAAGAATTCAAATTAGTACTCTAATACTGCACGG
28set5′ hlp TTGAGAATTCGATAAGCCTGCAAACAACCCTGTAG 578103
28set3′ CCAAGAATTCGGTTTATTTGTTTTCGTCAGCTTC
Pilin1 ftpA GACCACACAGTGCCAGGT 220101–102
PilinR2 GCGTTGCCATACGTTCAGC
Momp-for-2 momp CTGCACCAGATGCCAATACC 700103
Momp-rev-2 TGATAACCCTACAGAAACAGAATG
OmpA2-for-5 ompA2 TGGATTAGCGCGTAACGATTATAGTG 315101–102
OmpA2-rev-5 GCTCGTCCATCATCATTTGCG
TdhA-for-2 tdhA TGATAAAGGCAACCACTACCCAC 550102
TdhA-rev-2 CTGCGCGACAGTATTAATCCAAGG
HgbA-for-2 hgbA GCTCAGGTTATGCTATTCGTGGTGT 549101–102
HgbA-rev-2 CATAGCCTAGGGTAAAGCGGTTGGT
Lst-for-1 lst GGTTACGTGGTTTAGATGTTTATGGTGC 423101–102
Lst-rev-1 CGATATATATCAATCTTTTCTGCTTCTGTC
LosB-for-1 losB CGTAATAGGGATTTATTGCTTTTGAGAG 513102–103
LosB-rev-1 CAGCAATATGCACAATAGAAGTATCAGGTG
Cdt3 cdtB AGGCGGTTCTGATGCGGTAAG 359102
Cdt4 AGCGATCACGAACAAAACTAACAG
HhdA-for-1 hhdA GGCGGTCAAAATATAATGGAAAGAG 565102–103
HhdA-rev-1 TCGTGCCCGGCTTGGATACTAC
P10 lspA1 TTGAATTCAAGTTTCAGCAGGGACAGCAAATATC 264101–102
P11 TTTCTCGAGTCTAATTTTTCGGCGACAAGG
P12 lspA2 AAGTTTCAGCAAGAGCGGC 320102–103
P13 TATTGGCTGCAAGCTCTG
β-actin 5′ β-actin ATCTGGCACCACACCTTCTACAATGAGCTCCG 837ND
β-actin 3′ CGTCATACTCCTGCTTGCTGATCCACATCTGC
  • a Value represents the range of limits of detection for three experiments. ND, not determined.