Table 1.

Oligonucleotide primers used for RT-PCR analysis ofpmp genes

GeneSequence (5′ to 3′) of:
Forward primerReverse primer
pmpG1GGGAGTTTAACATCGATTTCTGTACCGGCAATGGAAACCTTCTGAAAACG
pmpG2CGTGATTTTAGTGATTCGGAGAAATCGCTTAAATTTGATTTTGCTACC
pmpG3CCACGTTTATATGGGTTTTCTTCGCTTGAGGAGGTATTTTCAG
pmpG4CGAGGGTGTCATATGAGATCGCCCAGAAGCTGCTGTATTGCTAAC
pmpG5GGATCAACCAGCCTGTCACTGTCTTGCAAGGTATGGTTCTC
pmpG6CCACGTATCTTTGACGCTAGCCGGAGAATCTTCGAAAGAATAACGAGTTCC
pmpG7CCTCTTCTTGAACTTACCACCTCGCAATTCCTGAAAGCC
pmpG8CCCAAGCATCTTTCTATGAAAATACCCGAATGTTAGGGCTTTATCAGC
pmpG9TACACTCCTCCAGCCCAAACTCGACTGAATAGAACAAGCTCC
pmpG10GGGTTTATGAAATCGCAATTTTCCCGCTAAGAAAGTAAGACTCGAAAATCC
pmpG11TCTTTCCAACCCACATCCTCCTACCCCTCAGTAAAAATGCC
pmpG12GAGGAAACCATGACCATACTTCGAAATTTTCTTACCCTGAGGTGAACGCTAAGTAAG
pmpG13CATCTCTACGTGCAAATGAAAACGCTGACTAAATCCTGAAAAACTCAAGGG
pmpHGGAGATCTGCAACGTAGCAAATGTGGATTTTAGTCCTGTAGACACTCG
pmpE/F1CTTTGAGAAGAATGTCTGTCCCCCCACTATAAATCCCTCCTCC
pmpE/F2CTACTTTGTCAACAATTCCGTCTAAATCGCCCCTCCTGAAC
pmpE/F3CTACTTTGTCAACAATTCCGTCTAAATCGCCCCTCCTGAAC
pmpE/F4ATCCAGAACACCTCGGAACAATCCATAGCTTGGGAGCAAC
pmpAGGCTATAACTTATTAGGACTCGGTCACATTGGATTCCGAGAAGAGCCC
pmpB/CGTGAATATATCTGATAGGGGAGTGTAGGTTTGAGGATCG
pmpDCGTTTTGAGAATGTCGCCCCCTGTCACATCGAACTCGAAAATAATACG