Table 1.

Oligonucleotide primers used in this study

PrimerNucleotide sequence (5′ → 3′)
tcf-1CATTTATTCTCAGGGGGAGCG
tcf-2CATCCTCTTTATCTGTTGCCACG
bcf-1TCCCCCGGGGATACTACAACCGTCACTGG
bcf-2GCGGATAAATCACCCTGGTC
saf-1TGTTCTGGCTCCTTGTTTGACG
saf-2TTCTGTTTGACCTCCACCCGAG
sta-1CCGAATTCAGTTGAAGGCGGCCAGATCG
sta-2CACCCGGGCGTCGTTATCGTTACCCAGGTC
stb-1CCGTCGACCGTTTCAATGCCAGACCGTAGC
stb-2CCGAATTCTGTTTCTGATAACACCATCACC
stc-1CCGAATTCTGTTGATGAGTATGATTCAGG
stc-2GACCCGGGGACTTCTTTCTTCTCTGCC
std-1CCGAATTCAGTCGATCCACCAACAGCAGG
std-2CACCCGGGGACGGAAAATGTCAGGGTAATCAG
ste-1ATAGCGTGTGGAGTGGGAATGC
ste-2ATAGCGTGTGGAGTGGGAATGC
stg-1CCGAATTCATCTGATGGCACCGTTCACTTCC
stg-2CACCCGGGATCCTTTGGCAACTCACC
sth-1GACCCGGGGGTTACGGTTGCGGAACCATCG
sth-2GTATTGTAATGGGCTGTGGTGTCTC