Table 2.

Oligonucleotides used in this study

NameNucleotide sequencea(5′-)Comments
CS3-01ATACTTATTAATAGGTCTTTDetection of CS3; hybridizes to CS3 pilin gene
CS3-02TTGTCGAAGTAATTGTTATADetection of CS3; hybridizes to CS3 pilin gene
CSA-01TGACTTAGTCAGGATAATTGDetection of CS1; hybridizes to cooA gene
CSA-02TGGAGTTTATATGAAACTAADetection of CS1; hybridizes tocooA gene
EST-01CATGTTCCGGAGGTAATATGAADetection of STI
EST-02AGTTCCCTTTATATTATTAATADetection of STI
LT-04CATCGCCATTATATGCAAATGGCGDetection of LT; hybridizes toeltA gene
LT-05ACTGATTGCCGCAATTGAATT GGGDetection of LT; hybridizes to eltB gene
RNS-01TTTGTAGGTATAAGATGGACDetection of rns
RNS-02AATTGCTTTGGTGTAACACCDetection of rns
TT1ATCTGTTTGTT G AGCTC AGCAATCTATTTGCAACCConstruction of ΔompF mutation; includes SacI site
TT2TTTTTTGCCAGCATGC CGGCAGCCACGCGTAGTGConstruction of ΔompF mutation; includes SphI site
TT3 CTCGAGGCTTAGCTCTATTTATTACCCTCATGGConstruction of ΔompF mutation
TT4 GAGCTAAGCCTCGAGTAATAGCACACCTCTTTGConstruction of ΔompF mutation
TT7TTGCTGGAAA GTCGA CGGATGTTAATTATTTGTGConstruction of ΔompC mutation; includes SalI site
TT8GGCCAAAGCC GAG CTC ATTCACCAGCGGCCCGACGConstruction of ΔompC mutation; includes SacI site
TT9 GCTAAGCCTCGAGTAATCTCGATTGATATCCGConstruction of ΔompC mutation
TT10 CTCGAGGCTTAGCGTTATTAACCCTCTGTTAConstruction of ΔompC mutation
TT11AACTGGTACC G TCGACGGCACAACGATTTATTGConstruction of ΔhtrA mutation; includes SalI site
TT12CCCATTCAGT GCA TGCGGGAGTATTCTCCTConstruction of ΔhtrA mutation; includes SphI site
TT13 CTCGAGTCTAGACTCCCTCAACCCCTTCCTConstruction of ΔhtrA mutation
TT14 TCTAGACTCGAGAGTATTTCAGTCTCGATTAConstruction of ΔhtrA mutation
TT15GAGTCACGCC G TCGACGTTTTCAATCTCCACCCAConstruction of ΔompR mutation; includes SalI site
TT16GCCTATCGCC G AGCTCATAATCGCCAGCGTATAGConstruction of ΔompR mutation; includes SacI site
TT17 GCTAAGCGCATGCGAGGCGATTGCGCTTCTCConstruction of ΔompR mutation
TT18 GCATGCGCTTAGCTGTTTGTACTCCCAAAGGTConstruction of ΔompR mutation
TT19CCGCGCTCGC TCTAGA GTGAACTGATCAACAATAConstruction of ΔaroC mutation; includes XbaI site
TT20ATGCGCGCGA GAGCTC AACCAGGGTCGCACTTTGConstruction of ΔaroC mutation; includes SacI site
TT21 CTCGAGGCATGCTGAATAAAACCGCGATTGConstruction of ΔaroC mutation
TT22 GCATGCCCTCGAGGGCTCCGTTATTGTTGTGConstruction of ΔaroC mutation
TT26AATGGA GAA TTC ATGAAACTAAAGAAAACAConstruction of pKCS1; hybridizes to cooA of CS1 operon; includesEcoRI site
TT27 TGGCTTAAGCTTTTAGTGATGATGATGATGATGCGT TGACTTAGTCAGGATAATTGConstruction of pKCS1; hybridizes to cooA of CS1 operon; includesHindIII site
  • a Restriction endonuclease sites incorporated into the oligonucleotides for cloning purposes are in boldface. Regions of the oligonucleotides that do not hybridize to the target DNA are underlined.