Table 1.

A. actinomycetemcomitans serotype-specific PCR assay

ReactionPrimerSequencea(5′–3′)SerotypePCR product size (bp)Region amplifiedbGenBank accession no.
1P11 TCTCCACCATTTTTGAGTGG b33312780–13112 AB002668
P12 GAAACCACTTCTATTTCTCC c26812808–13075 AB010415
P13 CCTTTATCAATCCAGACAGC f2324813–5044 AF213680
P14 ARAAYTTYTCWTCGGGAATG
2P15 TGGGTCATGGGAGGTACTCC a2938021–8313 AB046360
P16 GCTAGGAACAAAGCAGCATC
3P17 TGGAACGGGTATGGGAACGG d41111462–12034 AB041226
P18 GGATGCTCATCTAGCCATGC
4P19 ATTCCAGCCTTTTGGTTCTC e31117118–17427 AB030032
P20 TGGTCTGCGTTGTAGGTTGG
  • a R = A or G; Y = C or T; W = A or T.

  • b GenBank nucleotide sequence coordinates.