Table 1.

Oligonucleotides and conditions used for RT-PCR

GeneOligonucleotideOligonucleotide sequenceProduct (bp)No. of cycles
GAPDHhgap+GGCTCTCCAGAACATCATCC26523
hgap−GTCGCTGTTGAAGTCAGAGG
egr-1 egr+TCACCTATACTGGCCGCTTT50232
egr−TGAGTGGCAAAGGCCTTAAT
MIP-2αmip2a+AGCAGGAGCGCCCCTGGC17235
mip2a−GATTTTCTTAACCATGGGC
IL-8LK055ATGACTTCCAAGCTGGCCGTGGCT28930
LK056TCTCAGCCCTCTTCAAAAACTTCTC
zyxin 1 + zyxin 2zyx+CGAGGGCTGTTACACTGACA35135
zyx−TCATCTGCCTCAATCGACAG
ETR101etr+GAAGTGCAGAAAGAGGCACA45735
etr−ATGACGCTCCCTCCTCTTCT
IEX-1LIEX+GTGGTGAGTATCGCCGAAGT36035
IEX−GGTGTTGCTGGAGGAAAGTG
Mouse GAPDHCR127AGAACATCATCCCTGCATCC49923
CR128CTGGGATGGAAATTGTGAGG
Mouseegr-1 msegr+TGAGCACCTGACCACAGAGTCC50235
msegr−TCAGGTCTCCCTGTTGTTGTGG