TABLE 1

qPCR primer information

GeneSequencea (5′–3′)Reference or source
gapdhFw, TGGGCCCATGAAAGGAAT39
Rv, ACCAGCGTCAAAGATGGATG
IL-6Fw, GGACGTGAAGACACTCAGAGACGThis study
Rv, AAGGTTTGAGGAGAGGAGTGCTG
IL-8Fw, TGCATTGAAACAGAAAGCCGACGThis study
Rv, ATCTCCTGTCCAGTTGTCATCAAGG
IL-17aFw, CAATCTGAGGACGGAAAGGGThis study
Rv, ACTGGGCTTCAAAGATGACC
IFNFw, TGGGCGATCAAGGAAAACGAThis study
Rv, TTGATGCTTTAGCCTGCCGT
TNFFw, CGCATTTCACAAGCGAATTT39
Rv, CTGGTCCTGGTCATCTCTCC
  • a Fw, forward; Rv, reverse.