Table 1.

Oligonucleotides used in this study

Gene (bp)Primer name5′ start positionaPrimer sequence (5′-3′)Length (bases)Annealing temp (°C)
ipgD(1617)1660−355TATCAGGCTCGGAGTGTTAT2051
1662605TCGGCGTCAGAAGAGAAGTC20
1661547GACCAGAGTTATTATCACAG2049
16631474TATTAGCACATCATCATCAA20
mxiC(1067)1814−11GTAGGTGATGTATGCTTG1847
18161068GATCACTTTCATCTCCTG18
mxiA(2066)1817−3GAGATGAAAGTGATCCAG1848
1818999AAATGTACCAGTATAGCC18
1819946ATTATAAAAAGGTCGTAG1846
18202004AGCATACGATATAACGAG18
  • a Refered to the first base (A) in the ATG start codon.