Table 2.

Oligonucleotide primers and probes used for PCR-Southern blot analysis of murine chemokinesa

Target, cycle no.5′ and 3′ oligonucleotidesAntisense probeProduct size (bp)c
CRG-2/IP-10 (CXCL10), 24 TGAGCAGAGATGTCTGAATC ATTAGGACTAGCCATCCACTGGGTAAAGGG 399
TCGCACCTCCACATAGCTTACAG
Eotaxin (CCL11), 24 TAGGTAAGCAGTAACTTCCATCTGTCTC GATGCACCCTGAAAGCCATAGTCTTCAAGAC 380
TGACTAAATCAAGCAGTTCTTAGGCTCTG
JE/MCP-1 (CCL2), 26 CACTCACCTGCTGCTACTCATTCAC TCACTGTCACACTGGTCACTCCTACAGAAG 505
GGATTCACAGAGAGGGAAAAATGG
KC (CXCL1-3), 28 TTGACCCTGAAGCTCCCTTGGTTC CTCTCTGCACTTCTTTTCGCACAACACCCT 521
CGTGCGTGTTGACCATACAATATG
LIX (CXCL5), 30 GGGATCTTGTCCACAATGAG ACGGAGCTGCGTTGTGTTTGCTTAACCGTA 547
AGGGACAATGGTTTCCCTT
Lymphotactin (XCL1), 24 TGCAATGGGTTTGGGAACTG AACTTACAAACCCAGCGGCTGCCAGTTCAA 439
CAAGACCTCAGCCATGAGAC
MCP-3 (CCL7), 24 GCCAGCTCTCTCACTCTCTTT AGCTACAGAAGGATCACCAGTAGTCGGTGT 430
CAACACATTTCATCAACAG
MCP-5 (CCL12), 25 GTTCCTGACTCCTCTAGCTTTC GTTAAGCAGAAGATTCACGTGCGGAAGCTG 397
ACGTAAGAGTTTTTGGAACTC
Mig (CXCL9), 29 GATCAAACCTGCCTAGATCC CTCTTATGTAGTCTTCCTTGAACGACGACG 399
GGCTGTGTAGAACACAGAGT
MIP-2 (CXCL1-3), 29 CCTGGTTCAGAAAATCATCC AGACAGCGAGGCACATCAGGTACGATCCAG 468
TCCCCAGTCTCTTTCACTGT
MIP-1α (CCL3), 25 CGGAAGATTCCACGCCAATTC AGGAGATGGAGCTATGCAGGTGGCAGGAAT 448
GGTTGAGGAACGTGTCCTGAAG
MIP-1β (CCL4), 23 CCCACTTCCTGCTGTTTCTCTTAC AATCTGAACGTGAGGAGCAAGGACGCTTCT 444
AGCAGAGAAACAGCAATGGTGG
MIP-1γ (CCL9), 28 GCCCACTAAGAAGATGAAGCCT TGCTGCCTGTCCTATAACTCACGGATTCAG 416
CCTTCTCTAAAGCAAATGTTA
RANTES (CCL5), 23 CCACGTCAAGGAGTATTTCTACACC GCTAGGACTAGAGCAAGCAATGACAGGGAA 326
CTGGTTTCTTGGGTTTGCTGTG
SDF-1α (CXCL12), 24 CTCCAAACTGTGCCCTTCAG TGGCAAACCTTAGCATGACCCCAGTCAGTG 348
AAAGCTCCATTGTGCACGGG
SDF-1β (CXCL12), 26 CTCCAAACTGTGCCCTTCAG CAGCAAAACTGTGCAAAGCAAGTCCCTTGC 368
GCCTGTCACCAATGACGTTG
HPRT,b22 GTTGGATACAGGCCAGACTTTGTTG GTTGTTGGATATGCCCTTGAC 162
GATTCAACTTGCGCTCATCTTAGGC
  • a RT-PCR and Southern hybridization conditions are described in Materials and Methods.

  • b Housekeeping gene used for normalization.

  • c bp, base pairs.