Table 2.

PCR primers and templates for probe preparation and genomic sequence analysis

PCR productSize (bp)PCR primeraPCR template
LeftRight
eibAprobe1,000pr172pr173pCS6379
eibE probe785pr219pr234CH6249
eaaA probe737Standard vectorStandard vectorpDC6181
eaaC min 42.0b 1,250pr196pr197CH6304
K-12 min 42.0b 989pr221pr197K-12
  • a Primer sequences were as follows: pr172, CTGTTTTGTCTGCGGCAATGGC; pr173, TTACCCACGCTGTACGGCTGGAAC; pr196, GGCCGTATGCTGATGTCTGTG; pr197, CCTGGGAACTTGGCTTTAATC; pr219, CTAGGACGGCAAAGTGTG; pr221, CGATGGCACCTGTCTATG; pr234, ACGCCCATGTTGTAGGAC.

  • b The primers for amplifying the insert end and chromosomal attachment site relative to eibC were based on the sequences of eaaC (pr196) and the bacterialyecN (pr221) and yecD (pr197) genes.