Table 2.

List of the primers used for PCR amplification of various DNA fragments

GeneSense sequenceSiteAntisense sequenceSiteSize (bp)
oriColE1GCTCTAGACGCTCTTCCGCTTCCTCGXbaIGCTCTAGATTTAATTTAAAAGGATCTAGGTGAXbaI891
P23CGGAATTCGAAAAGCCCTGACAACCCEcoRICGGGATCCAACATCATTGTCATTCATATTTTTBamHI180
P59CGGAATCCAGAAAATACACTAACCAAAGAAGEcoRICGGGATCCCTTTATTCAGTTTTCAATGGTCTAGCBamHI180
lucCGCGGATCCTTAAAAAGAGGGAATAAAATGBamHITTCTGCAGTTACAATTTGGACTTTCCGCPstI1,600
clfACGGGATCCGAGGGAATAAAATGAATATGAAGABamHIACGCGTCGACATCATTATTACTTATTTCTTATCTTTATSalI2,823