Table 2.

Oligonucleotides used for PCR

PrimerPCR methodStrandSequence (5′–3′)a, b
P3PCRDOP+AATCTGCAGYTNMGNCAYCAYYTNAANGT
P4PCRDOPCCAAGCTTNARNACYTCNACYTTPTCYTG
P9IPCRM+CCAGATCTGGATGGCTTAAGCCTTATC
P10IPCRMAAAGATCTTATCTGGGCCATGTTCCTG
P24phoP specificACTTTATCTTGCCAGCTTT
P27phoP specific+CGCGTTGTTGCGTCACCAT
P41phoPamplification+ACCTATCACCAGATATTGGCGTG
P42phoPamplificationCCCATCATCATTCTACTGATGTGCG
  • a Underlined nucleotides representPstI (P3), HindIII (P4), and BglII (P9 and P10) restriction endonuclease sites.

  • b R = A or G; Y = C or T; M = A or C; N = A, C, G, or T.