Table 1.

Oligonucleotide sequences used to amplify the P. luminescens genes from pSB417a

GenePrimerSequenceRestriction endonucleases
luxA XAF3 CCCCGGATCCTGCAGATGAAGCAAGAGGAGGACTCTCTATG .... BamHI,PstlI
XAR GGCGGATCCGTCGACTTAATATAATAGCGAACGTTG .... BamHI,SalI
luxB XBF GGGAATTCTC GAGGAGGAGAGAAAGAAATGAAATTTGGA ....               EcoRI,XhoI
XBR GGCGGATCCGTCGACTTAGGTATATTCCATGTGGTAC .... BamHI,SalI
luxC XCF GGGAATTCTC GAGGAGGATGGCAAATATGACTAA .... EcoRI,XhoI
XCR GGCGGATCCGTCGACTTATGGGACAAATACAAGGAAC .... BamHI,SalI
luxD XDF GGGAATTCTC GAGGAGGAGTAAAAGTATGGAAAATGA .... EcoRI,XhoI
XDR GGCGGATCCGTCGACTTAAGACAGAGAAATTGCTTGA .... BamHI,SalI
luxE XEF GGGAATTCTC GAGGAGGAAAACAGGTATGACTTCATATG .... EcoRI,XhoI
XER GGCGGATCCGTCGACTTAACTATCAAACGCTTCGGTTA .... BamHI,SalI
  • a Oligonucleotide sequences used to amplify the P. luminescens luxA, B, C,D, and E genes from pSB417 by PCR (see main text for PCR conditions). Nucleotides highlighted in bold show the positions and sequences of the different restriction sites (identified in far-right column) incorporated to facilitate cloning. Gram-positive RBSs sites are underscored by solid lines. Start and stop codons are underscored by broken lines.