Table 2.

Oligonucleotide primers used to amplify virulence-associated genes

Target geneOligonucleotide sequence (5′→3′)Predicted size of amplified product (bp)Reference
cnf1CATGCTTCTTCCTCAGTAGC25551
GTCTAAAAGGGGGGCAGCCA
cnf2CTTCTTCAGTTGTTCCTCCG58351
TAAGGCGGGCACAAACCAGA
hlyCGCCAGAACAGTGCTTATCCT1,576This work
CCAGTTCCCCATTACACAGA
iutAGGTGACGGCTTTCTCTTCG189This work
TCTTGTTGTTCAGCCCTCCG
papCGACGGCTGTACTGCAGGGTGTGGCG32832
ATATCCTTTCTGCAGGGATGCAATA
tRNApheRAGCCGCGCTTTGGTACAGTAGC1,168This work
CAGATGGAACTGGTGCTGGAAGG