TABLE 2

Primers used in this study

Primer purpose and primerDescriptionSequencea
Mutagenesis
    mrkH-P1-FAmplifies kanamycin resistance cassette from pKD4 for insertion into mrkH (type 3 pilus regulatory gene)TCAGAATGTTGCTATTGCTATAAGAAAAATCAAACGCCTCACGACAACTATTTACAAGGGGTGTAGGCTGGAGCTGCTTC
    mrkH-P2-RAmplifies kanamycin resistance cassette from pKD4 for insertion into mrkH (type 3 pilus regulatory gene)AGATTGAGTGACCAATGAGATTGTCATTGGTGTACAGAAATATACTGTCCAAGGTTGTCACATATGAATATCCTCCTTAG
    mrkHcheckFVerifies TOP52 ΔmrkH sequenceCCGGTCTCCAGCTTGGAGGC
    mrkHcheckRVerifies TOP52 ΔmrkH sequenceGCACAGCCCGACAATGTCGC
    mrkA-P1-FAmplifies kanamycin resistance cassette from pKD4 for insertion into mrkA (type 3 pilus subunit gene)GCTGACCTCAGAATAAAAATACAAGCGGCGGACATTGCCGCTTTATTATTGTTATTAACTGTGTAGGCTGGAGCTGCTTC
    mrkA-P2-RAmplifies kanamycin resistance cassette from pKD4 for insertion into mrkA (type 3 pilus subunit gene)TTCTGGTTCTATGCGAATTCACAGTGTGCTCATTGATTCGTAATTCACTCTGACAAGGAACATATGAATATCCTCCTTAG
    mrkAcheckFVerifies TOP52 ΔmrkA sequenceATTGTTGGCATGGGCCGCA
    mrkAcheckRVerifies TOP52 ΔmrkA sequenceCAGCATCGCCTGATGTTTCTGG
    fimS-P1-FAmplifies kanamycin resistance cassette from pKD4 for insertion into fim operon (type 1 pilus operon)GAAAGAAATAATCTTTTAGAGGAAAAAGACCAGAAGAAGAAAAATGAATTAACAGATTGAGTGTAGGCTGGAGCTGCTTC
    fimK-P2-RAmplifies kanamycin resistance cassette from pKD4 for insertion into fim operon (type 1 pilus operon)GATATTCGCGCATGACGTACCGGCACCGGTGCTAACCGGTGCGCTTTTCTCGCACCCTCA CATATGAATATCCTCCTTAG
    fimScheckFVerifies TOP52 ΔfimS-K sequenceCACGTTTCGCTGGCATCTGG
    fimKcheckRVerifies TOP52 ΔfimS-K sequenceCAGCTGGTGGCGAAGGTAGTGG
    rfaH-P1-FAmplifies kanamycin resistance cassette from pKD4 for insertion into rfaH (transcription antitermination gene)CGCGATTACACCAGCCATTTGTTATGCTTGCCGTTATTAGAAGTGGAATGAGTCATTATGGTGTAGGCTGGAGCTGCTTC
    rfaH-P2-RAmplifies kanamycin resistance cassette from pKD4 for insertion into rfaH (transcription antitermination gene)GAGGCGCAAACGGACGCAAACGTCAGGGCGCTGTTTGGCGTCGACATTAACGGCGTTTAGCATATGAATATCCTCCTTAG
    rfaHcheckFVerifies TOP52 ΔrfaH sequenceTACGGTGTTCGACGGCGCG
    rfaHcheckRVerifies TOP52 ΔrfaH sequenceTGCCGCATATCCTGGCCAG
qRT-PCR
    qrpoB-FAmplifies rpoB (housekeeping gene)CTGATGCCTCAGGATATGATCAAC
    qrpoB-RAmplifies rpoB (housekeeping gene)CTGGCTGGAACCAAAGAACTCT
    qfimA-FAmplifies fimA (type 1 pilus gene)GGACCGTGCATTTTAAAGGA
    qfimA-RAmplifies fimA (type 1 pilus gene)GGCCTAACTGAACGGTTTGA
    qmrkA-FAmplifies mrkA (type 3 pilus gene)CCTGTTTAGTGCCATCAGCA
    qmrkA-RAmplifies mrkA (type 3 pilus gene)CTCCGGTAACCCTGACTGAA
Phase assay
    KlebphaseFAmplifies fimS for orientation analysisGGGACAGATACGCGTTTGAT
    KlebphaseRAmplifies fimS for orientation analysisGGCCTAACTGAACGGTTTGA
  • a All primers are listed in the 5′-3′ orientation.