Table 1.

Oligonucleotide primers and probes used in this study

Primer designationSequence (5′-3′)Purpose
ErpC-primeCGAATGTATCAGAGTCTCCCTTCCcp32-2 cloning and sequencing
BB-2TCCAGACTTATCAACACTAAAAGACGAACACcp32-2 cloning and sequencing
Cp-2AGGAATAACAATGAAAATTATCAACATATTATTTTGcp32-2 sequencing
ErpC-Lp2AGGAGCTATTGATTGTAAAAAAACACTCCACcp32-2 sequencing
mlpA/F-5′AATTTTATTTTTACTCAACATATTGTACTGGAGpCR2.1 cloning
mlpA-3′ATTAGGACCCATTGCCGCAGGTAGpCR2.1 cloning
mlpB-5′ACGGTTCAAGCAATATACATGCpCR2.1 cloning
mlpB-3′AATGTTTTTAGTTGTCCCAATCACpCR2.1 cloning
mlpC/D-5′GCTACTACCTCACTTAAAGAATATCAATTCpCR2.1 cloning
mlpC-3′GGGCTGTTAGATTATTAGCCACpCR2.1 cloning
mlpD-3′TGAATTTTTGCACGTACTACTTGCAGpCR2.1 cloning
mlpF-3′AGCTATTAGGAACCACCATTGTTGpCR2.1 cloning
mlpG/H/I/J-5′CTACTACCTCACTTAAAACATATCAATTCpCR2.1 cloning
mlpG-3′ATTGCAGGTAGCAGTTGCTTGATCTGpCR2.1 cloning
mlpH-3′TATTAGGAACCGTTGCATGTAGpCR2.1 cloning
mlpI-3′CGATATTATTGCTGAGCTTGGCpCR2.1 cloning
mlpJ-3′TTGAGAAATGTTTTTAGTTTTGCCpCR2.1 cloning
MlpA/C/F/H-His5′CCGCTCGAGAATTCTAATGATAATGACACHistine-tagged fusion primers
MlpB-His5′CCGCTCGAGAATGCTAATGATAATGATACHistine-tagged fusion primers
MlpD-His5′CCGCTCGAGAATTCTAATGATACTAATAATAGCCHistine-tagged fusion primers
MlpG-His5′CCGCTCGAGAATTCTAATGATACAAATACCAAGCHistine-tagged fusion primers
MlpI-His5′CCGCTCGAGAATTCTAATGATACTAATACTAGCCHistine-tagged fusion primers
MlpJ-His5′CCGCTCGAGAATTCCAATGATAATGACACHistine-tagged fusion primers
MlpG-His3′CGGGATCCTTATTGCAGGTAGCAGTTGCTTGHistine-tagged fusion primers
All(-G)His3′CGGGATCCTATGACCATGATTACGCCAAGCHistine-tagged fusion primers
mlpA5′NPTGTAATGGAAATGATGCAGACCAACNorthern probe primers
mlpA3′NPCATTGCCGCAGGTAGTAACTGCNorthern probe primers
mlpB5′NPTGGAAAAGGTACGAACGAAAAGAGNorthern probe primers
mlpB3′NPTTGTCCCAATCACTTGTAAGACCCNorthern probe primers
mlpC5′NPTCAAGCAGAACAACAAAAAACCACNorthern probe primers
mlpC3′NPGCCACCATTATTGCAGTTACTAACCNorthern probe primers
mlpD5′NPAATACCTTCAAGCAGGTCGTTCAGNorthern probe primers
mlpD3′NPTTATGAATTTTTGCACGTACTACTTGCNorthern probe primers
mlpF5′NPAGTTCAGGGTTTCTTTAGCGGCNorthern probe primers
mlpF3′NPGCTATTAGGAACCACCATTGTTGCNorthern probe primers
mlpG5′NPTGGAAATGATGAAGGAAAAAACACCNorthern probe primers
mlpG3′NPTTAATTGCAGGTAGCAGTTGCTTGNorthern probe primers
mlpH5′NPCAATGGAAAAGAAAATGGGGATGNorthern probe primers
mlpH3′NPTTAGGAACCGTTGCATGTAGTAGTTGNorthern probe primers
mlpI5′NPTTCAAAGAGGTGGTTAAGGGGGNorthern probe primers
mlpI3′NPTTGCTGAGCTTGGCAGGTACTACNorthern probe primers
mlpJ5′NPGGGGATGGTGACAACTTAATAGAGCNorthern probe primers
mlpJ3′NPTGCCAATTAGCTGTAAGACCAGCNorthern probe primers
mlpA/F-PEGTGTCATTATCATTAGAATTGCAGCTATTTAGTAGPrimer extension primers
mlpC-PEGGTTAAATCACGCTTTCCCCGTPrimer extension primers
mlpAprom-5′TGCCCTCTTCGAGGAACTTTATTACTTTGUpstream region cloning
mlpAprom-3′ATTAGGACCCATTGCCGCAGGTAGUpstream region cloning
mlpCprom-5′TGGAAACAGTGTCAACAAATATTGCAAGTGUpstream region cloning
mlpCprom-3′GGGCTGTTAGATTATTAGCCACUpstream region cloning