TABLE 2.

PCR primers used in this study

PrimerSequence (5′-3′)a
CBH1TGGCAGGACTGAATTTCTCAGG
CBH2GGTAGCATCGTAATACAACGGG
P1TGTGCTGCAAGGCGATTAAG
P3GGTTGATAATGAACTGTGC
PBH3GCGCTAATTGTGTTGCTTGT
BSH FGATTACTGCAGAGAATCAAT
BSH RGAAACAGAATTCAATTTGGTA
PVA FCTACAGACGGTGCCAATTATA
PVA RTGGTTTAGCCATATACTCTCC
BtlB FACTGGGCATGGCTTTATTG
BtlB RCGATCAATGCCGGGAAGA
CBH SOEAGTTCCGCTCTAGAAAATGCATCA
CBH SOEBCATTAAAAATCCCTCCTCAA
CBH SOECTTGAGGAGGGATTTTTAATGTTGGTGGGGGAAAATACG
CBH SOEDTGCAATAAGTCGACCAATAATGG
PVA SOEACACATTGGATCCGAACCGTCA
PVA SOEBCATAATTTATTCTCTCCTTCAAA
PVA SOECTTTGAAGGAGAATAAATTATGGGTGACCCTGATTTCACACAAT
PVA SOEDGATAAGGAATTCTTGGATCTACAG
BtlB SOEAGGTGAAAAGCTTCGAATGGTTT
BtlB SOEBCATGTAATCTCCTCCGTATT
BtlB SOECAATACGGAGGAGATTACATGCCGGAGCAAGTGACTCA
BtlB SOEDGTATCTAGATTTTTCGTTACTGT
PVA pPL2RCAATTCTTGGATCTAGAGATTCC
BtlB pPL2FCACTTTCTAGAGAACTTGGCAG
BtlB pPL2RCGTTACTGCAGTCTCTTTTTTG
PL102TATCAGACCTAACCCAAACCTTCC
PrfA FAATCTGCAGTCCATCAGGAGTTTCTTTAC
PrfA RACGGATCCATCATGAATTTACAATACTAC
SigB FGGTGAATTCAAACGGTTTTTACGTG
SigB RCGCTCATCTAGAACAGGGAGAAC
L142GAGTGCTTAATGCGTTAG
U141TTGCTCTTCCAATGTTAG
MONO7FGGCTAATACCGAATGATGAA
LisRAAGCAGTTACTCTTATCCT
  • a Overhangs complementary to the corresponding SOEB primers are underlined. Restriction enzyme sites are in boldface.