Table 2.

Linkers and primers used in this study

Primer or linkerDesigned regionSequence (5′-3′)a
Primer
 TETRF tetRC′-terminal senseTTTTTAAG CTT CTTAATGAGGTCGG
 TETRR tetR C′-terminal antisenseTTTTTTCCGCGGCCACTTTCACATTTAAGTTGTTT
 HAP401F ScHAP4ADsenseTTTTCTGCAGTTCCGCGGTAACGAAAATAATGATCTCTGG
 HAP401R ScHAP4ADantisenseTTTTACATGTTATCGTCATTGTCCACTTGTT
 HAP402F ScHAP4ADsenseTTTTACATGTCTTTATTGAAT TTG CCAATTTTG
 HAP402R ScHAP4ADantisenseTTTTGGATCCTGAAGAAA CAA ATAGGTTTC
 HAP403F ScHAP4ADsenseTTTTTTTGATCAGGATGAAAGCGCTG
 HAP403R ScHAP4ADantisenseTTTTTTAGTACTTTGGTGTAGTCGTCATC
 HAP404F ScHAP4ADsenseTTTTAGTA CTT AAATCCAAAAAAATTTCTACGTCG
 HAP404R ScHAP4AD TTTTCTCGAGAAAATACTTGTACCTTTAAAAAATC
 PCAENO1F CaENO1 5′-flanking senseTTTTATCGATGGGATCAAGATTTGTTTACAGG
 PCAENO1R CaENO1 5′-flanking antisenseTTTCTGCAGAATATTCCTGAATTATCAATTGATG
 TADH101 ScADH1 3′-flanking senseTTTTCCCGGGTGGACTTCTTCGCCAGAGG
 HOP101 ScHOP1 5′-flanking antisenseTTTTCTGCAGACTAGTTTTCTGAGATAAAGCTGTTTTT
 HOP102SAL ScHOP1 5′-flanking antisenseTTTTGTCGACTTTTCTGAGAATAAAGCTGTTTTT
 TEFAF CaTEF3 5′-flanking senseTTTTGAATTCGGTACCTCATCGGATTTTGATTCAATGC
 TEFAR CaTEF3 5′-flanking antisenseTTTTCCCGGGTCGACGTTCCTGTATATTAGTTGCC
 TEFBF CaTEF3 N′-terminal senseTTTTACTAGTTGGAAAATGTCTGCTGCTAGT
 TEFBRN CaTEF3 N′-terminal antisenseTTTTGCGGCCGCAGAAGCAATGGCCAATAAAG
 TEFDBR CaTEF3 3′-flanking antisenseTTTTGGATGCTCTTCTTCTTCATCATCCTCC
 NMTAF CaNMT1 5′-flanking senseTTTTGGATCCTATAGCCAACTACTCCATAAATT
 NMTAR CaNMT1 5′-flanking antisenseTTTTGTCGACTTGATCGTTAATTGTTTTTAC
 NMTBF CaNMT1 N′-terminal senseTTTTACTAGTTAGAATATGTCGGGAGATAAC
 NMTBRN CaNMT1 N′-terminal antisenseTTTTGCGGCCGCCAATCTTTTCTCCATCCC
 NMT3SPH CaNMT1 3′-franking antisenseCTACTAGTCATAGCATGCAAATGGGATGAGATTG
Linker
 TETRFL tetR N′-terminal senseGATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAG
 TETRRL tetR N′-terminal antisenseAGCTCTAATGCGCTGTTAATCACTTTACTTTTATCTAATCTAGACATCTGCA
 HAFLTriple HA epitope senseTCGAGCAGCTAGCTACCCATACGATGTTCCGGATTACGCTTACCCTTACGAT GTGCCGGATTACGCTTACCCATACGATGTACCGGATTACGCTAG
 HARLTriple HA epitope antisenseCTCAATCACACAGCTAGCGTAATCCGGTACATCGTATGGGTAAGCGTAATC CGGCACATCGTAAGGGTAAGCGTAATCCGGAACATCGTATGGGTA
  • a Italic letters indicate the restriction enzyme site. Underlined italic letters indicate replaced codons for CTG.