TABLE 1.

Nested primers used for validation of RT-PCR products

GenePrimer nameSequence (5′ → 3′)PCR product size (bp)
ALS1RTALS1ChFCCATCACTGAAGATATCACCACA239
RTALS1ChRTGGAGCTTCTGTAGGACTGGTT
ALS2RTALS2ChFGGTGCAATGGGGTTCATAGT223
RTALS2ChRTCTGGCCTGACACCAGAGTA
ALS3RTALS3ChFCCAAGTGTTCCAACAACTGAAA292
RTALS3ChRGAACCGGTTGTTGCTATGGT
ALS4RTALS4ChFTGGGATTTTCAACTGCTGGT308
RTALS4ChRGCTGACTCGTGTTGCAGAAA
ALS5RTALS5ChFTGGCACCACAATGTGAAAAC263
RTALS5ChRCCGGCAGGAACATTTTGATA
ALS6RTALS6ChFCGCAAGGGTTATTCCAAGT98
RTALS6ChRTGAAAATCCGAGCACACC
ALS7RTALS7ChFTTCCATGTCGCTCGATACAA117
RTALS7ChRGAACAATCAATTTCAAAATCATCATC
ALS9RTALS9ChFACAGCTAATTCACAAGTTTCTCAAA141
RTALS9ChRTGAAGTTTGATATTGAGTGACAGC