TABLE 1.

QRT-PCR primers used in this study

ORFaTarget genePrimer sequences (5′-3′)bPosition in ORF (bp)Amplicon size (bp)
16S rRNAF: TGTTACAATGGGAGGGACAAAGGG1231-1348118
R: TTACTAGCGAATCCAGCTTCACGG
PG0520groELF: CGGCTACATCTCTCCCTACTTCGT591-711121
R: GAGGATCGGGAGCATCTCTTTCAG
PG0521groESF: CCTCTCAAGGGTGAAGTAATCGCT103-19391
R: ATTTGCCGTAGAGTACGGTGTCTC
PG1208dnaKF: CTGACCGGTGAGGTAAAGGATGTC1126-1245120
R: CTTCGTCGGGATAGTGGTATTGGC
PG0593htrAF: GAGCCAAAGAAATGACGGTAACGC419-51597
R: ACTTTCAGCAAGGCTATGTCGGTC
PG1089rprYF: CCATCGCGATCGATGATCAGGTAA440-543104
R: GGCATAGTTGCGTTCAAGGGTTTC
PG1240tetRF: CCGCCAAGATCTTACTCCACTCAA449-557109
R: TCCACATTCTCACTGATTCGCTCG
PG1545sodBF: AAAGAGCGAAGGCGGTATCT174-313140
R: CGAATGAGCCGAATTGTTTGTC
PG0618ahpCF: TCAAACTCAATGCCTATCACAATG35-12187
R: GATAGAAAACGACCAAAGACCACT
PG0619ahpFF: CGGCCAATATCGACATCCTCCTCA1199-1309111
R: TTTGCTTTTCCTCTCCCGTGTTGC
PG1134trxBF: ATAGACGGAGAAAAGGAAATCACA289-427139
R: AGAAAAATCCATCACAGGTAGCAC