TABLE 1.

Specific PCR primer sets used in RT-PCR analysis

GenePrimeraSequence (5′→3′)Start siteReference or sourceb
speBFwdGGATCCATATGGATCAAACTTTGCTCGTAACG8112
RevGAATTCGGATCCTAAGGTTTGATGCCTACAACAG1175
speFFwdATGGCGCAAGCAAGTACCTA97731
RevTTTGAGTAGGTGTACCTTAT1624
speXFwdTTTCTCGTCCTGTGTTTGGA12210
RevTTGTGATATTAAAAATTTTCTCGCC574
speGFwdACCCCATGCGATTATGAAAA47978
RevGGGAGACCAAAAACATCGAC4966
speJFwdTCTTTCATGGGTACGGAAGTG41This study
RevAGCTCTCGACCTCAGAATCAA238
sagAFwdCTCGCGTTCTTATCAGTTAC1402
RevACCTGGCGTATAACTTCC339
sagBFwdTGTCCGCCAATAACTGTTGA727This study
RevCACCGTATTCCGCAAAATCT1365
sloFwdACTCTGTCACTGATAGGACC698This study
RevGAGCTGCTTCAATCTGTG998
csrSFwdTGGGTTTTCCATGACACAAA140023
RevAGCGCCGCGTAGTAATTAAG1594
csrRFwdTGCAACATGAGGGGTATGAA22023
RevTAAACCTGCAACCACATCCA531
emm1FwdAACGGCTTCAGTAGCGGTAG108211
RevCTGCAACTTCCATTGCATTC1281
sdaD (DNase)FwdCACAACAGCCAGGGAATTTT92537
RevGATGGTCTTGGTCCTCCTTG1105
16S rRNAFwdGCAGCAGTAGGGAATCTTCG330This study
RevCGCTCGGGACCTACGTATTA530
oppAFwd-1ATGAAGAAAAGTAAATGGTT138236
Fwd-2GATCCACGGACCTACCTTGA2901
Rev-1TTATTTTTCAACGTGATCAG3352
Rev-2CAGCTGCCACAACATCCTTA3003
dacAFwd-1AGGCGATGACCCACTAGGGA101536
Fwd-2TATTAGCTCCTAAAAATG559
dppAFwdGAAAACTGCAGTGACTGAGGCGCATTCGACA124735
RevGGCCGGAATTCTCAGAAGATGTCATTGCTT2189
rofAFwdATCGCTCTGCTATATAGTAAG520This study
RevACCGTCTCAGTGCTATCAA2031
pelFwdAGGAGGTAAACCTTATGTT24
RevGCTAAATAGATTATTTACCTG
oppFRevTTACAATTCTTTTTGATATT784036