TABLE 1.

Specific PCR primer sets used in RT-PCR analysis

GenePrimeraSequence (5′→3′)Start siteReference or sourceb
speB FwdGGATCCATATGGATCAAACTTTGCTCGTAACG81 12
RevGAATTCGGATCCTAAGGTTTGATGCCTACAACAG1175
speF FwdATGGCGCAAGCAAGTACCTA977 31
RevTTTGAGTAGGTGTACCTTAT1624
speX FwdTTTCTCGTCCTGTGTTTGGA122 10
RevTTGTGATATTAAAAATTTTCTCGCC574
speG FwdACCCCATGCGATTATGAAAA4797 8
RevGGGAGACCAAAAACATCGAC4966
speJ FwdTCTTTCATGGGTACGGAAGTG41This study
RevAGCTCTCGACCTCAGAATCAA238
sagA FwdCTCGCGTTCTTATCAGTTAC140 2
RevACCTGGCGTATAACTTCC339
sagB FwdTGTCCGCCAATAACTGTTGA727This study
RevCACCGTATTCCGCAAAATCT1365
slo FwdACTCTGTCACTGATAGGACC698This study
RevGAGCTGCTTCAATCTGTG998
csrS FwdTGGGTTTTCCATGACACAAA1400 23
RevAGCGCCGCGTAGTAATTAAG1594
csrR FwdTGCAACATGAGGGGTATGAA220 23
RevTAAACCTGCAACCACATCCA531
emm1 FwdAACGGCTTCAGTAGCGGTAG1082 11
RevCTGCAACTTCCATTGCATTC1281
sdaD (DNase)FwdCACAACAGCCAGGGAATTTT925 37
RevGATGGTCTTGGTCCTCCTTG1105
16S rRNAFwdGCAGCAGTAGGGAATCTTCG330This study
RevCGCTCGGGACCTACGTATTA530
oppA Fwd-1ATGAAGAAAAGTAAATGGTT1382 36
Fwd-2GATCCACGGACCTACCTTGA2901
Rev-1TTATTTTTCAACGTGATCAG3352
Rev-2CAGCTGCCACAACATCCTTA3003
dacA Fwd-1AGGCGATGACCCACTAGGGA1015 36
Fwd-2TATTAGCTCCTAAAAATG559
dppA FwdGAAAACTGCAGTGACTGAGGCGCATTCGACA1247 35
RevGGCCGGAATTCTCAGAAGATGTCATTGCTT2189
rofA FwdATCGCTCTGCTATATAGTAAG520This study
RevACCGTCTCAGTGCTATCAA2031
pel FwdAGGAGGTAAACCTTATGTT 24
RevGCTAAATAGATTATTTACCTG
oppF RevTTACAATTCTTTTTGATATT7840 36