TABLE 1.

Oligonucleotide primers used in this study and results of PCRs to detect genes of pathogenicity island

PrimerSequence (5′-3′)Presence of genea
P2TACCTACAACCTCAAGCT
P4TACCCATTCTAACCAAGC
P6CCTAGGCGGCCAGATCTGAT
P7GCACTTGTGTATAAGAGTCAG
P9CGCAGGGCTTTATTGATTC
Arbi1GGCCACGCGTCGACTAGTAC(N)10 GATAT
Arbi2GGCCACGCGTCGACTAGTAC
Arbi3GGCCACGCGTCGACTAGTAC(N)10 TGACG
Arbi4GGCCACGCGTCGACTAGTAC(N)10 ACGCC
Arbi5GGCCACGCGTCGACTAGTAC(N)10 TACNG
P19ATTCAACGGGAAACGTCTTG
P20ACTGAATCCGGTGAGAATGG
PapG-FTTTGCGAGTGGAGTGTATTT
PapG-RTACCTAACCCAACCGAAAAT
PapC-FTGATATCACGCAGTCAGTAGC
PapC-RCCGGCCATATTCACATAA
R14-15-FGCCAGTGACACATACTGAGAGC+
R14-15-RCAGATGTACAGTGGCGCG
R2 plus R3-FGCTGTCAGAATATTTCGCTCG+
R2 plus R3-RAGTCCTGTCACGCTGAACG
R1 plus R2-FAGCCTTTCTGTTTTGAGCAT+
R1 plus R2-RTCGCTACTATTGATTCTTGC
R1 plus f447-FCCGCAAGAATCAATAGTAGC+
R1 plus f447-RCTGGCGAGAAGGGGATAATG
  • a PCR elaborated for detection of metV genomic island.