TABLE 1.

Primer sequences for genes whose expression in biofilm and planktonic cultures was compareda

GenePrimer sequence (5′ to 3′)
ForwardReverse
gyrAATTGTTGCTCGGGCTCTTCCAGATGCGGCTTGTCAGGAGTAACC
srtAGAAGCTTCCTGTAATTGGCGTTCATCGTTCCAGCACCATA
spaPTTTGCCGATGAAACGACCACTACTCGCACTCCCTTGAGCCTC
gbpCCGCATTTCTCCTTTTCTTGCCGACAACTCCTGATGAACCAACGC
dexAGCTGACTGCTTCTGGAGTTTGCAAGTGCCAAGACTGACGCTTTG
fruATGTAGGTCTCGGTTTGTGGGACTCTTGAGCCAATGCTTCTGGTG
wapATGACTTTGACTGATGTTGTCGGAGGAAAAATCCTCAGCATAAGGTCGC
wapECTTCTGATAAAGCAACCGCCTACAAGACCTAAGCCCATTCCAGTTC
  • a Primers were designated and analyzed with MacVector 7.2 software.