TABLE 1.

Primer sequences for genes whose expression in biofilm and planktonic cultures was compareda

GenePrimer sequence (5′ to 3′)
ForwardReverse
gyrA ATTGTTGCTCGGGCTCTTCCAGATGCGGCTTGTCAGGAGTAACC
srtA GAAGCTTCCTGTAATTGGCGTTCATCGTTCCAGCACCATA
spaP TTTGCCGATGAAACGACCACTACTCGCACTCCCTTGAGCCTC
gbpC CGCATTTCTCCTTTTCTTGCCGACAACTCCTGATGAACCAACGC
dexA GCTGACTGCTTCTGGAGTTTGCAAGTGCCAAGACTGACGCTTTG
fruA TGTAGGTCTCGGTTTGTGGGACTCTTGAGCCAATGCTTCTGGTG
wapA TGACTTTGACTGATGTTGTCGGAGGAAAAATCCTCAGCATAAGGTCGC
wapE CTTCTGATAAAGCAACCGCCTACAAGACCTAAGCCCATTCCAGTTC
  • a Primers were designated and analyzed with MacVector 7.2 software.