TABLE 2.

Primers used to construct the fruA, wapA, and wapE mutants by PCR restriction-ligation mutagenesisa

PrimerNucleotide sequenceb (5′ to 3′)Product size (bp)
FruA-P1TACAAGAATGGGCGTTGGCAGG968
FruA-P2 GGCGCGCCACACAAAAAAGACGGCACAG
FruA-P3 GGCCGGCCGCTGGCTATTTCAAAAAACGC799
FruA-P4GGCATTCCACAAGACCTAAGTC
WapA-P1TTTGATGCGGCTCCAAGTTGTGCG909
WapA-P2 GGCGCGCCTTACTGAAAGAAAGTGGTTCCC
WapA-P3 GGCCGGCCTTGTTGCTGTGGCAGGTGTC648
WapA-P4GAAATCCTCCGCTTCTATGG
WapE-P1CGCAATGGCAATCAGGAGTATG669
WapE-P2 GGCGCGCCTGACGCAAGGGCAACAACTG
WapE-P3 GGCCGGCCAAAGGCACTTCCCCTGATGC966
WapE-P4CCAACCATTTTAGCAACAGTCTG
Erm-19 GGCGCGCCCCGGGCCCAAAATTTGTTTGAT876
Erm-20 GGCCGGCCAGTCGGCAGCGACTCATAGAAT
  • a Primers were designated and analyzed with MacVector 7.2 software.

  • b AscI restriction sites are in boldface; FseI restriction sites are underlined.